Detection of nuclease and coagulase genes in Staphylococcus aureus of bovine mastitis, by using Polymerase Chain Reaction

Mastitis is a high-cost disease for the dairy industry and Staphylococcus aureus (S. aureus) is one of the most common etiological agents of contagious bovine mastitis in the world. The use of the technique of the Polymerase Chain Reaction (PCR) in the identification of S. aureus in bovine mastitis has been shown to be rapid, sensitive and specific, allowing a fast and accurate diagnosis that reduces costs and clinical complications. To identify the presence of strains of S. aureus isolates from milk samples, we standardized a PCR technique for the detection of genes coa or nuc, and then, we determined the reproducibility of both protocols using two control strains of S. aureus and 31 isolates from bovine mastitis. This study presents the results of the standardization of the PCRs for the genes nuc and coa, and the evaluation of their reproducibility. Materials and methods: Primers used for gene coa: 5'ATAGAGATGCTGGTACAGC3' (forward) and 5'GCTTCCGATTGTTCGATGC3' (reverse), and for gene nuc: 5'GCGATTGATGGTGATACGGTT3' (forward) and 5'AGCCAAGCCTTGACGAACTAAAGC3' (reverse). We used for the evaluation of the repeatability of the PCRs, two control strains S. aureus (ATCC 43300 and ATCC 29213) and 31 isolates of Staphylococcus obtained from a bovine mastitis study from the department of Boyacá (Colombia). Results: In the standardization of the PCR for the genes nuc and coa, it was determined that the ready-to-use reagent, 2X PCR Taq MasterMix with dye, works efficiently with both genes. The temperatures and times that had to be adjusted to obtain optimal results in both PCRs were in the hybridization phase, in the case of nuc gene at 56.7 ° C and 40 seconds, and in the case of coa gene at 60.4 ° C and 30 seconds. In addition, the evaluation of the reproducibility of the PCRs using isolates from bovine samples showed 100% for nuc gene and 90.32% for coa gene. Conclusions: The PCR techniques for nuc and coa genes are fast and accurate methods for the detection of strains of S. aureus obtained from milk samples from animals with symptoms of mastitis.